A. Below is the wild type sequence of the template DNA strand and the template strand for three mutations in a short stretch of nucleotides from the CFTR gene. For each of these, write the sequence of the messenger RNA and then the amino acid sequence for the corresponding part of the CFTR protein using the genetic code. Read the code beginning with the first nucleotide on the far left. The … simply means there is sequence to the left and the right of the nucleotides that you are considering.Wild type sequence:….TCATAGTTTCTCTTGTAGTATAAACCCCAG….RNA:Protein sequence:Mutant #1:…TCATAGTTGCTCTTGTAGTATAAACCCCAG…RNA:Protein sequence:Mutant #2:…TCATAGTTCTCTTGTAGTATAAACCCCAGT…RNA:Protein sequence:Mutant #3:…TCATAGTTTCTCTTGTACTATAAACCCCAG…RNA:Protein:B. Identify the type of mutation in each case:mutant #1:mutant #2:mutant #3:C. Which of the mutants is most likely to exhibit partial function? Explain your answer.